Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
FMDV-A_PKI

PKB-number: PKB282
Definition: 5'UTR pseudoknot PKI
Organism: foot-and-mouth disease virus, serotype A
Abbreviation: FMDV-A_PKI
RNA type: Viral 5 UTR
Keywords: Picornaviridae; aphtovirus
EMBL number: AY593751
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Clarke B.E. et al. (1987). Nucleic Acids Res. 15:7067-7079.
Stem sizes:
Loop sizes:
4 4
2 0 5
Position Paired:
388-391; 398-401
394-397; 407-410
Bracket view of structure:
       390       400       410
#     789|123456789|123456789|1234
$ 387 CCGUCGUUUCCGACGUAAAAGGAAGCAA=414
% 387 :((((::[[[[)))):::::]]]]::::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2008-8-14 PKB00282.HTML