Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
FMDV-A_PKII

PKB-number: PKB283
Definition: 5'UTR pseudoknot PKII
Organism: foot-and-mouth disease virus, serotype A
Abbreviation: FMDV-A_PKII
RNA type: Viral 5 UTR
Keywords: Picornaviridae; aphtovirus
EMBL number: AY593751
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Clarke B.E. et al. (1987). Nucleic Acids Res. 15:7067-7079.
Stem sizes:
Loop sizes:
4 4
2 0 5
Position Paired:
430-433; 440-443
436-439; 449-452
Bracket view of structure:
     430       440       450
#     9|123456789|123456789|1234567
$ 429 CCGCCUGUCCCGGCGUUAAAGGGAAGUAA=457
% 429 :((((::[[[[)))):::::]]]]:::::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2008-8-14 PKB00283.HTML