Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
FMDV-A_PKIII

PKB-number: PKB284
Definition: 5'UTR pseudoknot PKIII
Organism: foot-and-mouth disease virus, serotype A
Abbreviation: FMDV-A_PKIII
RNA type: Viral 5 UTR
Keywords: Picornaviridae; aphtovirus
EMBL number: AY593751
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Clarke B.E. et al. (1987). Nucleic Acids Res. 15:7067-7079.
Stem sizes:
Loop sizes:
4 4
2 0 5
Position Paired:
473-476; 483-486
479-482; 492-495
Bracket view of structure:
             480       490       500
#     123456789|123456789|123456789|
$ 471 ACCGCCUACCCCGGCGUUAACGGGGAACAA=500
% 471 ::((((::[[[[)))):::::]]]]:::::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2008-8-14 PKB00284.HTML