Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
FMDV-O1K_PKII

PKB-number: PKB286
Definition: 5'UTR pseudoknot PKII
Organism: foot-and-mouth disease virus, serotype O
Abbreviation: FMDV-O1K_PKII
RNA type: Viral 5 UTR
Keywords: Picornaviridae; aphtovirus
EMBL number: X00871
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Clarke B.E. et al. (1987). Nucleic Acids Res. 15:7067-7079.
Stem sizes:
Loop sizes:
4 3
3 0 5
Position Paired:
53-56; 63-66
60-62; 72-74
Bracket view of structure:
             60        70        80
#    123456789|123456789|123456789|
$ 51 ACCGUCCGGCCCGACGUAAAAGGGUGGUAA=80
% 51 ::((((:::[[[)))):::::]]]::::::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2008-8-14 PKB00286.HTML