Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
FMDV-O1K_PKIV

PKB-number: PKB288
Definition: 5'UTR pseudoknot PKIV
Organism: foot-and-mouth disease virus, serotype O
Abbreviation: FMDV-O1K_PKIV
RNA type: Viral 5 UTR
Keywords: Picornaviridae; aphtovirus
EMBL number: X00871
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Clarke B.E. et al. (1987). Nucleic Acids Res. 15:7067-7079.
Stem sizes:
Loop sizes:
4 3
2 0 5
Position Paired:
137-140; 146-149
143-145; 155-157
Bracket view of structure:
        140       150       160
#     6789|123456789|123456789|
$ 136 CCUUCGCUCGGAAGUAAAACGACAA=160
% 136 :((((::[[[)))):::::]]]:::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2008-8-14 PKB00288.HTML