Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
FMDV-C_PKII

PKB-number: PKB290
Definition: 5'UTR pseudoknot PKII
Organism: foot-and-mouth disease virus, serotype C
Abbreviation: FMDV-C_PKII
RNA type: Viral 5 UTR
Keywords: Picornaviridae; aphtovirus
EMBL number: AY593807
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Escarmis C. et al. (1995). Virus Res. 35:155-167.
Stem sizes:
Loop sizes:
4 4
2 0 5
Position Paired:
433-436; 443-446
439-442; 452-455
Bracket view of structure:
             440       450       460
#     123456789|123456789|123456789|
$ 431 ACCGUCUCUCCCGACGUUAAAGGGAUGUAA=460
% 431 ::((((::[[[[)))):::::]]]]:::::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2008-8-14 PKB00290.HTML