Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
EMCV-R_PKB

PKB-number: PKB293
Definition: 5'UTR pseudoknot PKB
Organism: encephalomyocarditis virus
Abbreviation: EMCV-R_PKB
RNA type: Viral 5 UTR
Keywords: Picornaviridae; cardiovirus
EMBL number: M81861
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Duke G.M. et al. (1992). J. Virol. 66:1602-1609.
Stem sizes:
Loop sizes:
4 3
2 0 5
Position Paired:
85 -88 ; 94 -97 
91 -93 ; 103-105
Bracket view of structure:
          90       100
#    456789|123456789|1234567
$ 84 ACGUGAAGGCUACGAUAGUGCCAG=107
% 84 :((((::[[[)))):::::]]]::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2008-8-14 PKB00293.HTML