Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
EMCV-R_PKC

PKB-number: PKB294
Definition: 5'UTR pseudoknot PKC
Organism: encephalomyocarditis virus
Abbreviation: EMCV-R_PKC
RNA type: Viral 5 UTR
Keywords: Picornaviridae; cardiovirus
EMBL number: M81861
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Duke G.M. et al. (1992). J. Virol. 66:1602-1609.
Stem sizes:
Loop sizes:
3 6
1 0 3
Position Paired:
108-110; 118-120
112-117; 124-129
Bracket view of structure:
        110       120       130
#     6789|123456789|123456789|
$ 106 AGGGCGGGUACUGCCGUAAGUGCCA=130
% 106 ::(((:[[[[[[))):::]]]]]]:


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2008-8-14 PKB00294.HTML