Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Mengo_PKB

PKB-number: PKB295
Definition: 5'UTR pseudoknot PKB
Organism: Mengovirus
Abbreviation: Mengo_PKB
RNA type: Viral 5 UTR
Keywords: Picornaviridae; cardiovirus
EMBL number: L22089
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Duke G.M. et al. (1992). J. Virol. 66:1602-1609.
[2] Martin L.R. & Palmenberg A.C. (1996). J. Virol. 70:8182-8186.
Stem sizes:
Loop sizes:
4 3
2 0 5
Position Paired:
86 -89 ; 95 -98 
92 -94 ; 104-106
Bracket view of structure:
         90       100
#    56789|123456789|12345678
$ 85 ACGUGAAGGCUACGAUAGUGCCAG=108
% 85 :((((::[[[)))):::::]]]::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2008-8-14 PKB00295.HTML