Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Mengo_PKC

PKB-number: PKB296
Definition: 5'UTR pseudoknot PKC
Organism: Mengovirus
Abbreviation: Mengo_PKC
RNA type: Viral 5 UTR
Keywords: Picornaviridae; cardiovirus
EMBL number: L22089
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Duke G.M. et al. (1992). J. Virol. 66:1602-1609.
[2] Martin L.R. & Palmenberg A.C. (1996). J. Virol. 70:8182-8186.
Stem sizes:
Loop sizes:
3 5
1 0 3
Position Paired:
109-111; 119-121
113-115; 128-130
117-118; 125-126
Bracket view of structure:
       110       120       130
#     789|123456789|123456789|12
$ 107 AGGGCGGGUCCUGCCGAAAGUGCCAA=132
% 107 ::(((:[[[:[[))):::]]:]]]::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2008-8-14 PKB00296.HTML