Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
HAV_PK1

PKB-number: PKB297
Definition: 5'UTR pseudoknot PK1
Organism: hepatitis A virus
Abbreviation: HAV_PK1
RNA type: Viral 5 UTR
Keywords: Picornaviridae; hepatovirus
EMBL number: M14707
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Brown E.A. et al. (1991). J. Virol. 65:5828-5838.
[2] Le S.Y. et al. (1993). Nucleic Acids Res. 21:2445-2451.
Stem sizes:
Loop sizes:
5 7
2 0 5
Position Paired:
42-46; 56-60
49-55; 66-72
Bracket view of structure:
             50        60        70
#    123456789|123456789|123456789|123
$ 41 AAGUCCAUGGUGAGGGGACUUGAUACCUCACCG=73
% 41 :(((((::[[[[[[[))))):::::]]]]]]]:


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2008-8-14 PKB00297.HTML