Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
HAV_PK2

PKB-number: PKB298
Definition: 5'UTR pseudoknot PK2
Organism: hepatitis A virus
Abbreviation: HAV_PK2
RNA type: Viral 5 UTR
Keywords: Picornaviridae; hepatovirus
EMBL number: M14707
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Brown E.A. et al. (1991). J. Virol. 65:5828-5838.
[2] Le S.Y. et al. (1993). Nucleic Acids Res. 21:2445-2451.
Stem sizes:
Loop sizes:
3 5
4 0 2
Position Paired:
73-75; 85-87
80-84; 90-94
Bracket view of structure:
            80        90       100
#    23456789|123456789|123456789|
$ 72 CGCCGUUUGCCUAGGCUAUAGGCUAAAUU=100
% 72 :(((::::[[[[[)))::]]]]]::::::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2008-8-14 PKB00298.HTML