Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
TMEV

PKB-number: PKB299
Definition: 5'UTR pseudoknot
Organism: Theiler's murine encephalomyelitis virus
Abbreviation: TMEV
RNA type: Viral 5 UTR
Keywords: Picornaviridae; cardiovirus
EMBL number: M20301
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Le S.Y. et al. (1993). Nucleic Acids Res. 21:2445-2451.
Stem sizes:
Loop sizes:
3 6
1 0 2
Position Paired:
87 -89 ; 97 -99 
91 -96 ; 102-107
Bracket view of structure:
        90       100       110
#    6789|123456789|123456789|
$ 86 ACGCGGGUACUGCGAUAGUGCCACC=110
% 86 :(((:[[[[[[)))::]]]]]]:::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2008-8-14 PKB00299.HTML