Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
antiHIV1-RT_1.3a

PKB-number: PKB301
Definition: RNA aptamer against HIV-1 reverse transcriptase
Organism:
Abbreviation: antiHIV1-RT_1.3a
RNA type: Aptamers
Keywords: SELEX; reverse transcriptase; HIV
EMBL number:
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Tuerk C. et al. (1992). Proc. Natl. Acad. Sci. USA 89:6988-6992.
Stem sizes:
Loop sizes:
5 4
2 2 4
Position Paired:
8 -12; 21-25
15-18; 30-33
Bracket view of structure:
            10        20        30
#   123456789|123456789|123456789|1234567
$ 1 GAAUAUCUUCCGAAGCCGAACGGGAAAACCGGCAUCU=37
% 1 :::::::(((((::[[[[::)))))::::]]]]::::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2008-8-14 PKB00301.HTML