Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
antiHIV1-NC_psi-50-1

PKB-number: PKB302
Definition: RNA aptamer against HIV-1 nucleocapsid protein
Organism:
Abbreviation: antiHIV1-NC_psi-50-1
RNA type: Aptamers
Keywords: SELEX; nucleocapsid; HIV
EMBL number:
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison,Structure probing
References: [1] Kim M.Y. & Jeong S. (2003). Mol. Cells 16:413-417.
Stem sizes:
Loop sizes:
7 4
3 1 4
Position Paired:
50-56; 65-71
60-63; 76-79
Bracket view of structure:
    50        60        70        80
#    |123456789|123456789|123456789|
$ 50 GCCAGUGGUUUGCAAUGCUGGUCCGGUGCGU=80
% 50 (((((((:::[[[[:)))))))::::]]]]:


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2008-8-14 PKB00302.HTML