Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
R2_retroPK_Sc

PKB-number: PKB305
Definition: R2 retrotransposon pseudoknot
Organism: Samia cynthia
Abbreviation: R2_retroPK_Sc
RNA type: Others
Keywords: retrotransposon
EMBL number:
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison,Structure probing,microarray binding
References: [1] Kierzek E et al. (2009). J. Mol. Biol. 390:428-442.
Stem sizes:
Loop sizes:
5 10
27 10 9
Position Paired:
69 -73 ; 122-126
78 -82 ; 94 -98
83 -85 ; 90 -92
101-104; 143-146
106-107; 141-142
108-111; 136-139
112-114; 119-121
Bracket view of structure:
      70        80        90       100       110       120       130       140
#    89|123456789|123456789|123456789|123456789|123456789|123456789|123456789|1234567
$ 68 AGUCCCAAGGGGGUCCUCUUCGGAGCGACCCAAGCCCAACGGCUGGCUUCGGCUGGGACCAUUGCGAGAGUUCGUGGGCG=147
% 68 :(((((::::((((((((::::))):)))))::[[[[:[[[[[[(((::::)))))))):::::::::]]]]:]]]]]]:


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2010-1-18 PKB00305.HTML