Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
R2_retroPK_Ch

PKB-number: PKB306
Definition: R2 retrotransposon pseudoknot
Organism: Coscinocera hercules
Abbreviation: R2_retroPK_Ch
RNA type: Others
Keywords: retrotransposon
EMBL number:
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison,Structure probing,microarray binding
References: [1] Kierzek E. et al. (2009). J. Mol. Biol. 390:428-442.
Stem sizes:
Loop sizes:
5 10
27 10 7
Position Paired:
60 -64 ; 113-117
69 -72 ; 86 -89
74 -76 ; 81 -83
92 -95 ; 132-135
97 -98 ; 130-131
99 -102; 125-128
103-105; 110-112
Bracket view of structure:
     60        70        80        90       100       110       120       130
#    9|123456789|123456789|123456789|123456789|123456789|123456789|123456789|123456
$ 59 AGUCCCAAGGGGGUACUCUACGGAGCGACCCAAGCCCAACGGCUGGCUUAGGCUGGGACGAACGAUAGUCCGUGGGCG=136
% 59 :(((((::::((((:(((::::)))::))))::[[[[:[[[[[[(((::::)))))))):::::::]]]]:]]]]]]:


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2010-1-18 PKB00306.HTML