Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
R2_retroPK_Cpr

PKB-number: PKB307
Definition: R2 retrotransposon pseudoknot
Organism: Callosamia promethea
Abbreviation: R2_retroPK_Cpr
RNA type: Others
Keywords: retrotransposon
EMBL number:
Submitted by: A.P.Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison,Structure probing,microarray binding
References: [1] Kierzek E. et al. (2009). J. Mol. Biol. 390:428-442.
Stem sizes:
Loop sizes:
5 10
27 10 9
Position Paired:
65 -69 ; 118-122
74 -78 ; 90 -94
79 -81 ; 86 -88
97 -100; 139-142
102-103; 137-138
104-107; 132-135
108-110; 115-117
Bracket view of structure:
          70        80        90       100       110       120       130       140
#    456789|123456789|123456789|123456789|123456789|123456789|123456789|123456789|123
$ 64 AGUCCCAAUGGGGUCCUCUUCGGAGCGACCCAAGCCCAACGGCUGGCUUCGGCUGGGACCAUGGCGAGAGUUCGUGGGCG=143
% 64 :(((((::::((((((((::::))):)))))::[[[[:[[[[[[(((::::)))))))):::::::::]]]]:]]]]]]:


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2010-1-18 PKB00307.HTML