Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
R2_retroPK_Spy

PKB-number: PKB308
Definition: R2 retrotransposon pseudoknot
Organism: Saturnia pyri
Abbreviation: R2_retroPK_Spy
RNA type: Others
Keywords: retrotransposon
EMBL number:
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison,Structure probing,microarray binding
References: [1] Kierzek E. et al. (2009). J. Mol. Biol. 390:428-442.
Stem sizes:
Loop sizes:
5 10
27 10 8
Position Paired:
61 -65 ; 114-118
71 -78 ; 83 -90
93 -96 ; 134-137
98 -99 ; 132-133
100-103; 127-130
104-106; 111-113
Bracket view of structure:
     60        70        80        90       100       110       120       130
#    9|123456789|123456789|123456789|123456789|123456789|123456789|123456789|12345678
$ 59 CAGUCCCGAAUGGGGUCCCCUUUUGGGGACCCAAGUCCAACCGCUGGCUUCGGCUGGGACUUCGCGUCAGUGUGUGGGCG=138
% 59 ::(((((:::::((((((((::::))))))))::[[[[:[[[[[[(((::::))))))))::::::::]]]]:]]]]]]:


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2010-1-18 PKB00308.HTML