Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
IFNG_PK_C_familiaris

PKB-number: PKB310
Definition: Regulatory pseudoknot of the interferon-gamma gene 5'-UTR
Organism: Canis familiaris (dog)
Abbreviation: IFNG_PK_C_familiaris
RNA type: mRNA
Keywords: translation; PKR
EMBL number: NW_876250
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Mutagenesis,Sequence comparison,Structure probing
References: [1] Cohen-Chalamish S. et al. (2009). Nature Chem. Biol. 5:896-903.
Comment: This pseudoknot can adopt alternative conformations, conserved in mammalian IFN-gamma mRNAÕs [1]. Here the numbering corresponds to the structure as given in [1] and differs from the database entry for genomic contig (NW_876250).
Stem sizes:
Loop sizes:
6 33
0 2 6
Position Paired:
9  -14 ; 64 -69 
15 -16 ; 117-118
18 -18 ; 116-116
20 -20 ; 114-114
21 -24 ; 109-112
25 -28 ; 104-107
32 -33 ; 100-101
35 -35 ; 98 -98
38 -42 ; 92 -96
44 -47 ; 87 -90
51 -53 ; 83 -85
56 -61 ; 76 -81
Bracket view of structure:
            10        20        30        40        50        60        70
#   123456789|123456789|123456789|123456789|123456789|123456789|123456789|
$ 1 CAUUUUUCUGAUUGUCUACAGGUUGGCUAUUAGAAAAGAAAGAUCAGCUGAGUCCUUUGGACCUGAUCAA=70
% 1 ::::::::(((((([[:[:[[[[[[[[[:::[[:[::[[[[[:[[[[:::[[[::[[[[[[::)))))):

             80        90       100       110       120       130
#    123456789|123456789|123456789|123456789|123456789|123456789|
$ 71 CUUCAUCCAGGAGCUACUGACUUCAACUACUUCGGCCUAACUCUCUGAAACGAUGAAUUA=130
% 71 :::::]]]]]]:]]]:]]]]:]]]]]:]:]]::]]]]:]]]]:]:]]]::::::::::::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2010-1-18 PKB00310.HTML