Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
IFNG_PK_C_jacchus

PKB-number: PKB311
Definition: Regulatory pseudoknot of the interferon-gamma gene 5'-UTR
Organism: Callitrix jacchus (marmoset)
Abbreviation: IFNG_PK_C_jacchus
RNA type: mRNA
Keywords: translation; PKR
EMBL number: X64659
Submitted by: A.P.Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Mutagenesis,Sequence comparison,Structure probing
References: [1] Cohen-Chalamish S. et al. (2009). Nature Chem. Biol. 5:896-903.
Comment: This pseudoknot can adopt alternative conformations, conserved in mammalian IFN-gamma mRNA's [1].
Stem sizes:
Loop sizes:
6 36
0 4 8
Position Paired:
2651-2656; 2706-2711
2657-2658; 2761-2762
2660-2661; 2758-2759
2662-2664; 2754-2756
2665-2671; 2745-2751
2674-2678; 2739-2743
2680-2689; 2729-2738
2693-2695; 2725-2727
2698-2701; 2720-2723
Bracket view of structure:
             2660      2670      2680      2690      2700      2710
#      123456789|123456789|123456789|123456789|123456789|123456789|
$ 2651 UGAUCAUCUGAAGAUCAGCUAUUGGAAGAGAAAGAUCAGCCAAGUCCUUUGGACCUGAUC=2710
% 2651 (((((([[:[[[[[[[[[[[[::[[[[[:[[[[[[[[[[:::[[[::[[[[::::)))))

             2720      2730      2740      2750      2760      2770
#      123456789|123456789|123456789|123456789|123456789|123456789|
$ 2711 AACUUGAUACGAGAACUACUGAUUUCAACUUCUUUGGCUGAGCUCUCUCCGAAACAAUGA=2770
% 2711 )::::::::]]]]:]]]:]]]]]]]]]]]]]]]:]]]]]]]::]]]:]]:]]::::::::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2010-1-18 PKB00311.HTML