Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
IFNG_PK_M_musculus

PKB-number: PKB312
Definition: Regulatory pseudoknot of the interferon-gamma gene 5'-UTR
Organism: Mus musculus (mouse)
Abbreviation: IFNG_PK_M_musculus
RNA type: mRNA
Keywords: translation; PKR
EMBL number: M28621
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Mutagenesis,Sequence comparison,Structure probing
References: [1] Cohen-Chalamish S. et al. (2009). Nature Chem. Biol. 5:896-903
Comment: This pseudoknot can adopt alternative conformations, conserved in mammalian IFN-gamma mRNA’s [1]. Here the numbering corresponds to the structure as given in [1] and differs from the database entry which contains a partial sequence missing the 5’end of the mouse IFN-gamma mRNA.
Stem sizes:
Loop sizes:
5 20
2 14 17
Position Paired:
6  -10 ; 70 -74 
13 -16 ; 118-121
17 -19 ; 114-116
31 -35 ; 109-113
40 -41 ; 106-107
42 -43 ; 103-104
52 -55 ; 92 -95
60 -62 ; 66 -68
76 -79 ; 87 -90
Bracket view of structure:
            10        20        30        40        50        60        70
#   123456789|123456789|123456789|123456789|123456789|123456789|123456789|
$ 1 GCCAGAGAGGUGCAGGCUAUAGCUGCCAUCGGCUGACCUAGAGAAGACACAUCAGCUGAUCCUUUGGACC=70
% 1 :::::(((((::[[[[[[[:::::::::::[[[[[::::[[[[::::::::[[[[::::(((:::))):)

             80        90       100       110       120       130
#    123456789|123456789|123456789|123456789|123456789|123456789|
$ 71 CUCUGACUUGAGACAGAAGUUCUGGGCUUCUCCUCCUGCGGCCUAGCUCUGAGACAAUGA=130
% 71 )))):((((:::::::)))):]]]]:::::::]]:]]:]]]]]]]]:]]]]:::::::::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2010-1-18 PKB00312.HTML