Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
IFNG_PK_S_scrofa

PKB-number: PKB313
Definition: Regulatory pseudoknot of the interferon-gamma gene 5'-UTR
Organism: Sus scrofa (pig)
Abbreviation: IFNG_PK_S_scrofa
RNA type: mRNA
Keywords: translation; PKR
EMBL number: S63967
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Mutagenesis,Sequence comparison,Structure probing
References: [1] Cohen-Chalamish S. et al. (2009). Nature Chem. Biol. 5:896-903.
Comment: This pseudoknot can adopt alternative conformations, conserved in mammalian IFN-gamma mRNA’s [1].
Stem sizes:
Loop sizes:
5 28
0 4 9
Position Paired:
14 -18 ; 68 -72 
19 -20 ; 120-121
24 -26 ; 113-115
29 -31 ; 107-109
34 -35 ; 105-106
42 -51 ; 91 -100
54 -57 ; 87 -90
60 -63 ; 82 -85
Bracket view of structure:
            10        20        30        40        50        60        70
#   123456789|123456789|123456789|123456789|123456789|123456789|123456789|
$ 1 CUGCAGGUCAACGGAUCAUCUUCAGAUCAGCUAUUGCAGAAGAAAGGUCAGCCAAGCGCUCUGGGCCUGA=70
% 1 :::::::::::::((((([[:::[[[::[[[::[[::::::[[[[[[[[[[::[[[[::[[[[::::)))

             80        90       100       110       120       130
#    123456789|123456789|123456789|123456789|123456789|123456789|
$ 71 UCGACUGUAUAUAGGAGCUUCUGAUUUCAACCAGAAGCUAACUCUCUCCGAAACAAUGAG=130
% 71 )):::::::::]]]]:]]]]]]]]]]]]]]::::]]]]]:::]]]::::]]:::::::::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2010-1-18 PKB00313.HTML