Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
CPEB3_rz_Pt

PKB-number: PKB321
Definition: CPEB3 ribozyme
Organism: chimpanzee
Abbreviation: CPEB3_rz_Pt
RNA type: Ribozymes
Keywords: self-cleavage; hepatitis delta virus ribozyme; HDV-like ribozyme
EMBL number:
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Mutagenesis,Sequence comparison,ribozyme activity
References: [1] Salehi-Ashtiani K., Luptak A., Litovchick A. & Szostak J.W. (2006). Science 313:1788-1792.
Stem sizes:
Loop sizes:
7 7 3 1
2 0 2 4 0
Position Paired:
1 -7 ; 30-36
10-16; 61-67
17-19; 27-29
22-22; 37-37
39-45; 50-56
Bracket view of structure:
            10        20        30        40        50        60
#   123456789|123456789|123456789|123456789|123456789|123456789|1234567
$ 1 GGGGGCCACAGCAGAAGCGUUCACGUCGCGGCCCCUGUCAGAUUCUGGUGAAUCUGCGAAUUCUGCU=67
% 1 (((((((::[[[[[[[(((::[::::))))))))))]:(((((((::::)))))))::::]]]]]]]


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2010-1-18 PKB00321.HTML