Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
drz_Agam_2_1

PKB-number: PKB323
Definition: HDV-like ribozyme
Organism: Anopheles gambiae
Abbreviation: drz_Agam_2_1
RNA type: Ribozymes
Keywords: self-cleavage; hepatitis delta virus ribozyme; HDV-like ribozyme
EMBL number: BK006881
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison,ribozyme activity
References: [1] Webb CH, Riccitelli NJ, Ruminski DJ & Luptak A (2009). Science 326:953.
Stem sizes:
Loop sizes:
7 11 3 2
39 0 1 4 0
Position Paired:
1  -7  ; 72 -78 
13 -17 ; 39 -43
19 -22 ; 34 -37
23 -25 ; 30 -32
47 -50 ; 177-180
52 -58 ; 170-176
59 -61 ; 69 -71
63 -64 ; 79 -80
84 -95 ; 153-164
98 -103; 144-149
105-113; 119-127
133-136; 140-143
Bracket view of structure:
            10        20        30        40        50        60
#   123456789|123456789|123456789|123456789|123456789|123456789|
$ 1 GCUCUGCAAAUGGGGUAGGAGGCGAUGCCUCGUCCUCAUACCCAACUCCUAUUCCGGCAC=60
% 1 (((((((:::::(((((:(((((((::::))):)))):))))):::[[[[:[[[[[[[((

             70        80        90       100       110       120
#    123456789|123456789|123456789|123456789|123456789|123456789|
$ 61 GUCCACGUCGUGCAGAGCGGUAACAUGCGUUACUAGGGGUGCAAGAGCUCUUUUUGAGGA=120
% 61 (:[[::::))))))))))]]:::((((((((((((::((((((:(((((((((:::::))

             130       140       150       160       170       180
#     123456789|123456789|123456789|123456789|123456789|123456789|
$ 121 GGAGCUCUUUUUGCUGCACUAGUUGCAUCAGAUGGUAACGCAUGGCUAAGCCGGAAAGGG=180
% 121 ))))))):::::((((:::)))))))))):::)))))))))))):::::]]]]]]]]]]]


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2010-1-18 PKB00323.HTML