Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
drz_Agam_2_2

PKB-number: PKB324
Definition: HDV-like ribozyme
Organism: Anopheles gambiae
Abbreviation: drz_Agam_2_2
RNA type: Ribozymes
Keywords: self-cleavage; hepatitis delta virus ribozyme; HDV-like ribozyme
EMBL number: BK006882
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison,ribozyme activity
References: [1] Webb CH, Riccitelli NJ, Ruminski DJ & Luptak A (2009). Science 326:953.
Stem sizes:
Loop sizes:
7 10 3 2
42 0 1 4 0
Position Paired:
1  -7  ; 74 -80 
13 -20 ; 39 -46
22 -23 ; 34 -35
50 -53 ; 178-181
55 -60 ; 172-177
61 -63 ; 71 -73
65 -66 ; 81 -82
86 -95 ; 157-166
100-103; 153-156
108-114; 130-136
138-142; 147-151
Bracket view of structure:
            10        20        30        40        50        60        70
#   123456789|123456789|123456789|123456789|123456789|123456789|123456789|
$ 1 GUUCUGUAAACGGGGUUGGAUCCGACUCUCAUAGGCUCUCCAACCCAACUCCUACUCAAUACGUCCUCGU=70
% 1 (((((((:::::((((((((:((::::::::::)):::)))))))):::[[[[:[[[[[[(((:[[::::

             80        90       100       110       120       130       140
#    123456789|123456789|123456789|123456789|123456789|123456789|123456789|
$ 71 CGUACAGAACGGUAACAUGUUUUCCGAACAUCCGCGCUUGGGUAUACGAGUAUACACCUUACCCAACCCU=140
% 71 ))))))))))]]:::((((((((((::::((((::::(((((((:::::::::::::::))))))):(((

             150       160       170       180
#     123456789|123456789|123456789|123456789|1
$ 141 CGCCAACGGGGAGGAUGGAAAACAUGGCUAAAUUGAGAGGG=181
% 141 ((::::))))):)))))))))))))):::::]]]]]]]]]]


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2010-1-18 PKB00324.HTML