Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
drz_Bflo_1

PKB-number: PKB325
Definition: HDV-like ribozyme
Organism: Branchiostoma floridae
Abbreviation: drz_Bflo_1
RNA type: Ribozymes
Keywords: self-cleavage; hepatitis delta virus ribozyme; HDV-like ribozyme
EMBL number: BK006884
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison,ribozyme activity
References: [1] Webb CH, Riccitelli NJ, Ruminski DJ & Luptak A (2009). Science 326:953.
Stem sizes:
Loop sizes:
7 8 3 2
2 0 1 5 0
Position Paired:
1 -7 ; 32-38
10-16; 72-78
17-17; 70-70
18-20; 29-31
22-23; 39-40
44-50; 58-64
52-52; 56-56
Bracket view of structure:
            10        20        30        40        50        60        70
#   123456789|123456789|123456789|123456789|123456789|123456789|123456789|12345678
$ 1 GACACCCUUGGCAGAUGACCUCCUCGUUGGUGGGUGUCGGUAAUGUUGUCAGUCACAGGCAACAGCUAACGAUCUGCC=78
% 1 (((((((::[[[[[[[[(((:[[:::::))))))))))]]:::(((((((:(:::):))))))):::::]:]]]]]]]


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2010-1-18 PKB00325.HTML