Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
drz_Spur_3

PKB-number: PKB333
Definition: HDV-like ribozyme
Organism: Strongylocentrotus purpuratus
Abbreviation: drz_Spur_3
RNA type: Ribozymes
Keywords: self-cleavage; hepatitis delta virus ribozyme; HDV-like ribozyme
EMBL number: BK006889
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison,ribozyme activity
References: [1] Webb CH, Riccitelli NJ, Ruminski DJ & Luptak A (2009). Science 326:953.
Stem sizes:
Loop sizes:
6 7 3 2
2 0 1 4 0
Position Paired:
1 -6 ; 29-34
9 -15; 62-68
16-18; 26-28
20-21; 35-36
40-46; 50-56
Bracket view of structure:
            10        20        30        40        50        60
#   123456789|123456789|123456789|123456789|123456789|123456789|12345678
$ 1 GACACUGAGUGAGAAACGUCCCCGUCGUAGUGUCGGUAAUGCGUUGUUUCAACGUAGCCAAUUCUCAC=68
% 1 ((((((::[[[[[[[(((:[[::::)))))))))]]:::(((((((:::))))))):::::]]]]]]]


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2010-1-18 PKB00333.HTML