Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
drz_Spur_4

PKB-number: PKB334
Definition: HDV-like ribozyme
Organism: Strongylocentrotus purpuratus
Abbreviation: drz_Spur_4
RNA type: Ribozymes
Keywords: self-cleavage; hepatitis delta virus ribozyme; HDV-like ribozyme
EMBL number: BK006890
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison,ribozyme activity
References: [1] Webb CH, Riccitelli NJ, Ruminski DJ & Luptak A (2009). Science 326:953.
Stem sizes:
Loop sizes:
7 7 3 2
2 0 1 4 0
Position Paired:
1 -7 ; 30-36
10-16; 71-77
17-19; 27-29
21-22; 37-38
40-46; 59-65
48-50; 55-57
Bracket view of structure:
            10        20        30        40        50        60        70
#   123456789|123456789|123456789|123456789|123456789|123456789|123456789|1234567
$ 1 GGGUUGCACAGGAGCAGGGUCCACGUCCCGCAACCUGGGUGUCAUGAUUUCUUGAAGCCAUGAUAGCUGAUGCUCCU=77
% 1 (((((((::[[[[[[[(((:[[::::))))))))))]]:(((((((:(((::::))):))))))):::::]]]]]]]


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2010-1-18 PKB00334.HTML