Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
drz_Cjap_1

PKB-number: PKB335
Definition: HDV-like ribozyme
Organism: Caenorhabditis japonica
Abbreviation: drz_Cjap_1
RNA type: Ribozymes
Keywords: self-cleavage; hepatitis delta virus ribozyme; HDV-like ribozyme
EMBL number: BK006893
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison,ribozyme activity
References: [1] Webb CH, Riccitelli NJ, Ruminski DJ & Luptak A (2009). Science 326:953.
Stem sizes:
Loop sizes:
7 6 3 2
2 0 1 4 0
Position Paired:
1  -7  ; 30 -36 
10 -11 ; 103-104
13 -16 ; 99 -102
17 -19 ; 27 -29
21 -22 ; 37 -38
39 -40 ; 93 -94
43 -51 ; 84 -92
57 -61 ; 78 -82
62 -63 ; 75 -76
Bracket view of structure:
            10        20        30        40        50        60
#   123456789|123456789|123456789|123456789|123456789|123456789|
$ 1 GGUUUGCUUGUUGGAUACCUCCUCGCGGUGCAAACUGGGCAAUGCUGUGCUCCUACGACA=60
% 1 (((((((::[[:[[[[(((:[[::::))))))))))]]((::(((((((((:::::((((

             70        80        90       100
#    123456789|123456789|123456789|123456789|1234
$ 61 GGGGAAAUUGGACACCACUGUUAGGCACAGUAGCCAAAAUCCAC=104
% 61 (((:::::::::::)):))))):)))))))))))::::]]]]]]


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2010-1-18 PKB00335.HTML