Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
drz_Ppac_1_2

PKB-number: PKB337
Definition: HDV-like ribozyme
Organism: Pristionchus pacificus
Abbreviation: drz_Ppac_1_2
RNA type: Ribozymes
Keywords: self-cleavage; hepatitis delta virus ribozyme; HDV-like ribozyme
EMBL number: BK006892
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison,ribozyme activity
References: [1] Webb CH, Riccitelli NJ, Ruminski DJ & Luptak A (2009). Science 326:953.
Stem sizes:
Loop sizes:
7 8 3 2
2 0 1 4 0
Position Paired:
1  -7  ; 31 -37 
10 -16 ; 100-106
17 -17 ; 98 -98
18 -20 ; 28 -30
22 -23 ; 38 -39
41 -50 ; 83 -92
53 -59 ; 74 -80
64 -64 ; 69 -69
Bracket view of structure:
            10        20        30        40        50        60
#   123456789|123456789|123456789|123456789|123456789|123456789|
$ 1 GGUUCGCUUGACUGUUCACCUCCCCGUGGUGCGAGCUGGACACUAUCCACUCGCAUUUUU=60
% 1 (((((((::[[[[[[[[(((:[[::::))))))))))]]:((((((((((::(((((((:

             70        80        90       100
#    123456789|123456789|123456789|123456789|123456
$ 61 CACCCAUUGUAUUGAUUUGCUUGUGGAUGGUGACUGAGAAACAGUC=106
% 61 :::(::::)::::)))))))::)))))))))):::::]:]]]]]]]


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2010-1-18 PKB00337.HTML