Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
drz_Pmar_1

PKB-number: PKB338
Definition: HDV-like ribozyme
Organism: Petromyzon marinus
Abbreviation: drz_Pmar_1
RNA type: Ribozymes
Keywords: self-cleavage; hepatitis delta virus ribozyme; HDV-like ribozyme
EMBL number: BK006883
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison,ribozyme activity
References: [1] Webb CH, Riccitelli NJ, Ruminski DJ & Luptak A (2009). Science 326:953.
Stem sizes:
Loop sizes:
7 7 3 1
2 0 2 4 0
Position Paired:
1 -7 ; 30-36
10-16; 60-66
17-19; 27-29
22-22; 37-37
39-39; 55-55
42-45; 50-53
Bracket view of structure:
            10        20        30        40        50        60
#   123456789|123456789|123456789|123456789|123456789|123456789|123456
$ 1 GGGGAAGAAGAUGACAACCUUCUCGCGGUCUUCCCUGUUACGUGUGUAGACACAACGAAUGUCAUC=66
% 1 (((((((::[[[[[[[(((::[::::))))))))))]:(::((((::::)))):)::::]]]]]]]


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2010-1-18 PKB00338.HTML