Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
drz_CIV_1

PKB-number: PKB340
Definition: HDV-like ribozyme
Organism: Invertebrate iridescent virus 6
Abbreviation: drz_CIV_1
RNA type: Ribozymes
Keywords: self-cleavage; hepatitis delta virus ribozyme; HDV-like ribozyme
EMBL number: BK006895
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison,ribozyme activity
References: [1] Webb CH, Riccitelli NJ, Ruminski DJ & Luptak A (2009). Science 326:953.
Stem sizes:
Loop sizes:
7 8 3 2
1 0 1 5 0
Position Paired:
1 -7 ; 31-37
9 -15; 61-67
16-16; 59-59
17-19; 28-30
21-22; 38-39
44-46; 51-53
Bracket view of structure:
            10        20        30        40        50        60
#   123456789|123456789|123456789|123456789|123456789|123456789|1234567
$ 1 GAGGUGCUUGUAGAUAACCUCCACGAUGGUGCACCUUGGGCAACACAAAAGUGGCAAAUCAUCUACA=67
% 1 (((((((:[[[[[[[[(((:[[:::::))))))))))]]::::(((::::))):::::]:]]]]]]]


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2010-1-18 PKB00340.HTML