Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SAH_riboswitch

PKB-number: PKB343
Definition: SAH riboswitch aptamer domain
Organism: Ralstonia solanacearum
Abbreviation: SAH_riboswitch
RNA type: Aptamers
Keywords: SAH; riboswitch; S-adenosyl-(L)-homocysteine
EMBL number: 3NPQ
Submitted by: A.P. Gultyaev (goultiaevap2@chem.leidenuniv.nl)
Supported by: Crystal structure,Sequence comparison
References: [1] Wang JX et al. (2008). Mol. Cell 29:691-702.
[2] Edwards AL et al. (2010). RNA 16:2144-2155.
Comment: A representative structure of the SAH class of riboswitches. For simplicity, some of tertiary base interactions [1] are not shown here.
Stem sizes:
Loop sizes:
7 6
0 18 9
Position Paired:
1 -7 ; 32-38
19-20; 25-26
8 -13; 48-53
Bracket view of structure:
            10        20        30        40        50
#   123456789|123456789|123456789|123456789|123456789|1234
$ 1 GGACGAGGAGCGCUGCAAGCGAGAGCCCAGGCUCGUCCGUUCAAACGGCGCUCA=54
% 1 ((((((([[[[[[:::::((::::)):::::))))))):::::::::]]]]]]:


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2011-4-23 PKB00343.HTML