Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SAM-I_riboswitch

PKB-number: PKB344
Definition: SAM-I riboswitch aptamer domain
Organism: Thermoanaerobacter tengcongensis
Abbreviation: SAM-I_riboswitch
RNA type: Aptamers
Keywords: SAM; riboswitch; S-adenosylmethionine
EMBL number: 2GIS
Submitted by: A.P. Gultyaev (goultiaevap2@chem.leidenuniv.nl)
Supported by: Crystal structure,Mutagenesis,Sequence comparison,Structure probing
References: [1] Montange RK & Batey RT (2006). Nature 441:1172-1175.
[2] Lu C et al. (2010). J. Mol. Biol. 404:803-818.
[3] Hennelly SP & Sanbonmatsu KY (2011). Nucleic Acids Res. 39:2416-2431.
Comment: A representative structure of the SAM-I class of riboswitches.
Stem sizes:
Loop sizes:
10 4 1
1 0 22 0 16
Position Paired:
1 -8 ; 86-93
13-13; 41-41
15-20; 35-40
21-23; 29-31
42-44; 58-60
47-49; 54-56
64-64; 85-85
69-73; 78-82
25-28; 65-68
Bracket view of structure:
            10        20        30        40        50
#   123456789|123456789|123456789|123456789|123456789|
$ 1 GGCUUAUCAAGAGAGGUGGAGGGACUGGCCCGAUGAAACCCGGCAACCAG=50
% 1 ((((((((::::(:(((((((((:[[[[))):::)))))))(((::(((:

             60        70        80        90
#    123456789|123456789|123456789|123456789|1234
$ 51 AAAUGGUGCCAAUUCCUGCAGCGGAAACGUUGAAAGAUGAGCCA=94
% 51 :::))):))):::(]]]](((((::::)))))::))))))))):


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2011-4-23 PKB00344.HTML