Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SAM-II_riboswitch

PKB-number: PKB345
Definition: SAM-II riboswitch aptamer domain
Organism: Sargasso Sea metagenome
Abbreviation: SAM-II_riboswitch
RNA type: Aptamers
Keywords: SAM, riboswitch, S-adenosylmethionine
EMBL number: 2QWY
Submitted by: A.P. Gultyaev (goultiaevap2@chem.leidenuniv.nl)
Supported by: Crystal structure,Sequence comparison,Structure probing
References: [1] Gilbert SD et al. (2008). Nature Str. Mol. Biol. 15:177-182.
Comment: A representative structure of the SAM-II class of riboswitches. For simplicity, some of tertiary base interactions [1] are not shown here.
Stem sizes:
Loop sizes:
6 10
7 0 9
Position Paired:
2 -7 ; 25-30
15-21; 45-51
22-23; 42-43
24-24; 40-40
Bracket view of structure:
            10        20        30        40        50
#   123456789|123456789|123456789|123456789|123456789|12
$ 1 GCGCGGCGAUUUAACCGUAUUGCAGUCGCGUGAUAAAUGUAGCUAAAAAGGA=52
% 1 :((((((:::::::[[[[[[[[[[)))))):::::::::]:]]:]]]]]]]:


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2011-4-23 PKB00345.HTML