Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
WNV

PKB-number: PKB347
Definition: NS1' ribosomal frameshift site of West Nile virus
Organism: West Nile virus
Abbreviation: WNV
RNA type: Viral Frameshift
Keywords: Flaviviridae, ribosomal frameshifting
EMBL number: NC_009942
Submitted by: A.P. Gultyaev (goultiaevap2@chem.leidenuniv.nl)
Supported by: Mutagenesis,Sequence comparison
References: [1] Firth AE & Atkins JF (2009). Virol. J. 6:14.
[2] Melian EB et al. (2010). J. Virol. 84:1641-1647.
Comment:
Stem sizes:
Loop sizes:
11 7
6 3 17
Position Paired:
3558-3568; 3585-3595
3597-3598; 3603-3604
3575-3581; 3613-3619
Bracket view of structure:
        3550      3560      3570      3580      3590      3600
#      6789|123456789|123456789|123456789|123456789|123456789|
$ 3546 CCCUUUUCAGUUGGGCCUUCUGGUCGUGUUCUUGGCCACCCAGGAGGUCCUUCGC=3600
% 3546 ::::::::::::(((((((((((::::::[[[[[[[:::))))))))))):((::

             3610      3620
#      123456789|123456789|
$ 3601 AAGAGGUGGACAGCCAAGAU=3620
% 3601 ::))::::::::]]]]]]]:


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2011-4-23 PKB00347.HTML