Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
JEV

PKB-number: PKB348
Definition: NS1' ribosomal frameshift site of Japanese encephalitis virus
Organism: Japanese encephalitis virus
Abbreviation: JEV
RNA type: Viral Frameshift
Keywords: Flaviviridae; ribosomal frameshifting
EMBL number: NC_001437
Submitted by: A.P. Gultyaev (goultiaevap2@chem.leidenuniv.nl)
Supported by: Mutagenesis,Sequence comparison
References: [1] Firth AE & Atkins JF (2009). Virol. J. 6:14.
[2] Melian EB et al. (2010). J. Virol. 84:1641-1647.
Comment:
Stem sizes:
Loop sizes:
11 7
7 2 16
Position Paired:
3566-3576; 3593-3603
3605-3606; 3611-3612
3584-3590; 3620-3626
Bracket view of structure:
          3560      3570      3580      3590      3600      3610
#      456789|123456789|123456789|123456789|123456789|123456789|
$ 3554 CCCUUUUCAGCUGGGCCUUCUGGUGAUGUUUCUGGCCACCCAGGAGGUCCUUCGCAA=3610
% 3554 ::::::::::::(((((((((((:::::::[[[[[[[::))))))))))):((::::

             3620      3630
#      123456789|123456789|
$ 3611 GAGGUGGACGGCCAGAUUGA=3630
% 3611 )):::::::]]]]]]]::::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2011-4-23 PKB00348.HTML