Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
MVEV

PKB-number: PKB349
Definition: NS1' ribosomal frameshift site of Murray Valley encephalitis virus
Organism: Murray Valley encephalitis virus
Abbreviation: MVEV
RNA type: Viral Frameshift
Keywords: Flaviviridae; ribosomal frameshifting
EMBL number: NC_000943
Submitted by: A.P. Gultyaev (goultiaevap2@chem.leidenuniv.nl)
Supported by: Mutagenesis,Sequence comparison
References: [1] Firth AE & Atkins JF (2009). Virol. J. 6:14.
[2] Melian EB et al. (2010). J. Virol. 84:1641-1647.
Comment:
Stem sizes:
Loop sizes:
11 7
7 2 16
Position Paired:
3563-3573; 3590-3600
3581-3587; 3617-3623
Bracket view of structure:
             3560      3570      3580      3590      3600      3610
#      123456789|123456789|123456789|123456789|123456789|123456789|
$ 3551 UCCUUUUCAGUUAGGCCUUCUGGUGAUGUUUCUGGCCACCCAGGAGGUCUUGAGGAAGAG=3610
% 3551 ::::::::::::(((((((((((:::::::[[[[[[[::)))))))))))::::::::::

             3620      3630
#      123456789|123456789|
$ 3611 GUGGACGGCCAGACUUACUC=3630
% 3611 ::::::]]]]]]]:::::::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2011-4-23 PKB00349.HTML