Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
ALFV

PKB-number: PKB350
Definition: NS1' ribosomal frameshift site of Alfuy virus
Organism: Alfuy virus
Abbreviation: ALFV
RNA type: Viral Frameshift
Keywords: Flaviviridae; ribosomal frameshifting
EMBL number: AY898809
Submitted by: A.P. Gultyaev (goultiaevap2@chem.leidenuniv.nl)
Supported by: Mutagenesis,Sequence comparison
References: [1] Firth AE & Atkins JF (2009). Virol. J. 6:14.
[2] Melian EB et al. (2010). J. Virol. 84:1641-1647.
Comment:
Stem sizes:
Loop sizes:
11 6
8 2 16
Position Paired:
3566-3576; 3593-3603
3585-3590; 3620-3625
Bracket view of structure:
          3560      3570      3580      3590      3600      3610
#      456789|123456789|123456789|123456789|123456789|123456789|
$ 3554 CCCUUUUCAGCUGGGCCUCUUGGUAGUUUUCCUGGCCACCCAGGAGGUCUUGAGGAA=3610
% 3554 ::::::::::::(((((((((((::::::::[[[[[[::))))))))))):::::::

             3620      3630
#      123456789|123456789|
$ 3611 GAGGUGGACGGCCAGAAUGA=3630
% 3611 :::::::::]]]]]]:::::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2011-4-23 PKB00350.HTML