Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SESV

PKB-number: PKB353
Definition: 6K/TF ribosomal frameshift site of Seal louse virus
Organism: Seal louse virus
Abbreviation: SESV
RNA type: Viral Frameshift
Keywords: Togaviridae; Alphavirus; ribosomal frameshifting
EMBL number: AF315122
Submitted by: A.P. Gultyaev (goultiaevap2@chem.leidenuniv.nl)
Supported by: Mutagenesis,Sequence comparison
References: [1] Firth AE et al. (2008) Virol. J. 5:108.
[2] Chung BYW et al. (2010). J. Mol. Biol 397:448-456.
Stem sizes:
Loop sizes:
11 8
1 0 9
Position Paired:
1709-1719; 1729-1739
1721-1728; 1749-1756
Bracket view of structure:
             1700      1710      1720      1730      1740      1750      1760
#      123456789|123456789|123456789|123456789|123456789|123456789|123456789|
$ 1691 UUUGUUUUUUAGCUGUGCUGGGUGCGAGUGUGGCAGCGGCUCGUGCCUACGAACACACCGCUGUCAUGCC=1760
% 1691 ::::::::::::::::::(((((((((((:[[[[[[[[))))))))))):::::::::]]]]]]]]::::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2011-4-25 PKB00353.HTML