Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
R2_rz_Ds

PKB-number: PKB354
Definition: R2 ribozyme
Organism: Drosophila simulans
Abbreviation: R2_rz_Ds
RNA type: Ribozymes
Keywords: self-cleavage; hepatitis delta virus ribozyme; HDV-like ribozyme
EMBL number: U64957
Submitted by: A.P. Gultyaev (goultiaevap2@chem.leidenuniv.nl)
Supported by: Sequence comparison,ribozyme activity
References: [1] Eickbush DG & Eickbush TH (2010). Mol. Cell. Biol. 30: 3142-3150.
Stem sizes:
Loop sizes:
6 6 3 2
117 0 1 4 1
Position Paired:
3  -8  ; 145-150
126-131; 180-185
132-134; 142-144
136-137; 152-153
156-163; 168-175
Bracket view of structure:
            10        20        30        40        50        60
#   123456789|123456789|123456789|123456789|123456789|123456789|12345
$ 1 GAGGGAUCUGGGGUAAUUGCGAGCAGAGGGGGAGUAUUUUUCUGUAAUUCGUAAGUCAUAUCAUA=65
% 1 ::((((((:::::::::::::::::::::::::::::::::::::::::::::::::::::::::

        70        80        90       100       110       120       130
#    6789|123456789|123456789|123456789|123456789|123456789|123456789|
$ 66 UGGUGUGCGGAAGGGGAAUUUUACUCUGUAACUCACAAGUCUCUCCUUUACUCAAGUCGACUCAA=130
% 66 ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::[[[[[

             140       150       160       170       180       190
#     123456789|123456789|123456789|123456789|123456789|123456789|
$ 131 AACCUCCUCGUGGUGGUCCCCGGUAAUGCUAAACUUGUUUAGCAGCUAAUUUGAGCGGCA=190
% 131 [(((:[[::::))))))))):]]::((((((((::::))))))))::::]]]]]]:::::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2011-4-25 PKB00354.HTML