Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
R2_rz_Da

PKB-number: PKB356
Definition: R2 ribozyme
Organism: Drosophila ananassae
Abbreviation: R2_rz_Da
RNA type: Ribozymes
Keywords: self-cleavage; hepatitis delta virus ribozyme; HDV-like ribozyme
EMBL number: U64950
Submitted by: A.P. Gultyaev (goultiaevap2@chem.leidenuniv.nl)
Supported by: Sequence comparison,ribozyme activity
References: [1] Eickbush DG & Eickbush TH (2010). Mol. Cell. Biol. 30: 3142-3150.
Stem sizes:
Loop sizes:
7 6 3 2
67 0 1 4 0
Position Paired:
1  -7  ; 94 -100
75 -80 ; 127-132
81 -83 ; 91 -93
85 -86 ; 101-102
104-110; 115-121
Bracket view of structure:
            10        20        30        40        50
#   123456789|123456789|123456789|123456789|123456789|
$ 1 GGAGAAUAUGGAUUUGAUUGUGCAGAGGGGGUGCAAUACCGUAACUCGUA=50
% 1 (((((((:::::::::::::::::::::::::::::::::::::::::::

             60        70        80        90       100
#    123456789|123456789|123456789|123456789|123456789|
$ 51 AGCCAUGCAAUCAGAUCAAGUCGACUCAAAACCUCCUCGUGGUAUUCUCU=100
% 51 ::::::::::::::::::::::::[[[[[[(((:[[::::))))))))))

             110       120       130       140
#     123456789|123456789|123456789|123456789|
$ 101 GGGUGCCAGUAUUUACUGGUAGCUGAUUUGAGCGGCGAAA=140
% 101 ]]:(((((((::::))))))):::::]]]]]]::::::::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2011-4-25 PKB00356.HTML