Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots

PKB-number: PKB357
Definition: R2 ribozyme
Organism: Drosophila pseudoobscura
Abbreviation:
RNA type: Ribozymes
Keywords: self-cleavage; hepatitis delta virus ribozyme; HDV-like ribozyme
EMBL number: U64955
Submitted by: A.P. Gultyaev (goultiaevap2@chem.leidenuniv.nl)
Supported by: Sequence comparison,ribozyme activity
References: [1] Eickbush DG & Eickbush TH (2010). Mol. Cell. Biol. 30: 3142-3150.
Stem sizes:
Loop sizes:
7 6 3 2
72 0 1 4 0
Position Paired:
1  -7  ; 99 -105
80 -85 ; 149-154
86 -88 ; 96 -98
90 -91 ; 106-107
109-115; 137-143
Bracket view of structure:
            10        20        30        40        50        60
#   123456789|123456789|123456789|123456789|123456789|123456789|
$ 1 GGAAGAUAUGGGUCUGAAUAAUAGCGUAGAAGGGGAGUCAUUCCGUAAUUCGUAAAUCGU=60
% 1 (((((((:::::::::::::::::::::::::::::::::::::::::::::::::::::

             70        80        90       100       110       120
#    123456789|123456789|123456789|123456789|123456789|123456789|
$ 61 AAAAAUCAGAUCAAGUUGAUUCAAGACCUCCUCGUGGUAUCUUCUGGAUGCUAUUAGACU=120
% 61 :::::::::::::::::::[[[[[[(((:[[::::))))))))))]]:(((((((:::::

             130       140       150       160
#     123456789|123456789|123456789|123456789|
$ 121 GAAGUUCUUUUGGUCUAAUAGUAACUAACUUGAACAGCGA=160
% 121 ::::::::::::::::))))))):::::]]]]]]::::::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2011-4-25 PKB00357.HTML