Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
R2_rz_Df

PKB-number: PKB358
Definition: R2 ribozyme
Organism: Drosophila falleni
Abbreviation: R2_rz_Df
RNA type: Ribozymes
Keywords: self-cleavage; hepatitis delta virus ribozyme; HDV-like ribozyme
EMBL number: U64952
Submitted by: A.P. Gultyaev (goultiaevap2@chem.leidenuniv.nl)
Supported by: Sequence comparison,ribozyme activity
References: [1] Eickbush DG & Eickbush TH (2010). Mol. Cell. Biol. 30: 3142-3150.
Stem sizes:
Loop sizes:
7 6 3 2
107 0 1 4 0
Position Paired:
35 -41 ; 168-174
149-154; 212-217
155-157; 165-167
159-160; 175-176
178-183; 201-206
Bracket view of structure:
             40        50        60        70        80
#    123456789|123456789|123456789|123456789|123456789|
$ 31 UUAAGGAGGAUCAAAGGACUGAGAUGCAGAAGGGCCAUAUCAUUUGAAUA=80
% 31 ::::(((((((:::::::::::::::::::::::::::::::::::::::

             90       100       110       120       130
#    123456789|123456789|123456789|123456789|123456789|
$ 81 UGCUAUGUCGUACGUCAUAAGACAUCAAAGUCAAGUCGACUCGUAGACAC=130
% 81 ::::::::::::::::::::::::::::::::::::::::::::::::::

             140       150       160       170       180
#     123456789|123456789|123456789|123456789|123456789|
$ 131 UCUGUGUCCCACAAUUCAUUUGUGGCCUCCUCGUGGUAUCCUCCGGGUGC=180
% 131 ::::::::::::::::::[[[[[[(((:[[::::))))))))))]]:(((

             190       200       210       220
#     123456789|123456789|123456789|123456789|
$ 181 UAAAUUCAGUGUAGUUCUGAUUAGCAGCUAAUUCGAGCGA=220
% 181 (((:::::::::::::::::)))))):::::]]]]]]:::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2011-4-25 PKB00358.HTML