Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
ToxI_Pa

PKB-number: PKB359
Definition: ToxI RNA
Organism: Pectobacterium atrosepticum
Abbreviation: ToxI_Pa
RNA type: Others
Keywords: toxin-antitoxin system; triplex base interaction
EMBL number: 2XDB_G
Submitted by: A.P. Gultyaev (goultiaevap2@chem.leidenuniv.nl)
Supported by: Crystal structure
References: [1] Blower TR et al. (2011). Nature Str. Mol. Biol. 18:185-190.
Comment: For simplicity, some of tertiary interactions [1] such as base triplexes are not shown here.
Stem sizes:
Loop sizes:
4 3
4 1 6
Position Paired:
5 -8 ; 17-20
13-15; 27-29
Bracket view of structure:
            10        20        30        40
#   123456789|123456789|123456789|123456789|
$ 1 AUUCAGGUGAUUUGCUACCUUUAAGUGCAGCUAGAAAUUC=40
% 1 ::::((((::::[[[:))))::::::]]]:::::::::::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2011-4-25 PKB00359.HTML