Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
AV_ori

PKB-number: PKB361
Definition: 5\'-terminal ori region
Organism: Aichi virus
Abbreviation: AV_ori
RNA type: Viral 5 UTR
Keywords: Picornaviridae; IRES
EMBL number: AB040749
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Sweeney TR et al. (2012). J. Virol. 86:1468-1486.
Stem sizes:
Loop sizes:
10 3
1 0 44
Position Paired:
46 -55 ; 60 -69 
73 -76 ; 101-104
80 -82 ; 95 -97
84 -86 ; 91 -93
57 -59 ; 114-116
Bracket view of structure:
             50        60        70        80        90       100
#    123456789|123456789|123456789|123456789|123456789|123456789|
$ 41 UUUUCCGGUGGUCUGGUCCCGGACCACCGUUACUCCAUUCAGCUUCUUCGGAACCUGUUC=100
% 41 :::::((((((((((:[[[)))))))))):::((((:::(((:(((::::))):))):::

             110       120
#     123456789|123456789|
$ 101 GGAGGAAUUAAACGGGCACC=120
% 101 )))):::::::::]]]::::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2012-9-9 PKB00361.HTML