Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
CKoV_ori

PKB-number: PKB362
Definition: 5\'-terminal region
Organism: Canine Kobuvirus
Abbreviation: CKoV_ori
RNA type: Viral 5 UTR
Keywords: Picornaviridae; IRES
EMBL number: JN088541
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Sweeney TR et al. (2012). J. Virol. 86:1468-1486.
Stem sizes:
Loop sizes:
8 4
4 0 43
Position Paired:
14-21; 30-37
38-39; 73-74
41-44; 69-72
48-50; 63-65
52-54; 59-61
26-29; 81-84
Bracket view of structure:
            10        20        30        40        50        60
#   123456789|123456789|123456789|123456789|123456789|123456789|
$ 1 UCACGCACUUUUCCGGUGGUCCGGACCCAGACCACCGUCACUCCAUUCAGCUUCUUCGGA=60
% 1 :::::::::::::((((((((::::[[[[))))))))((:((((:::(((:(((::::))

             70        80        90
#    123456789|123456789|123456789|
$ 61 ACCUGUUCGGAGGAAUUAAAUGGGCACCCA=90
% 61 ):))):::))))))::::::]]]]::::::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2012-9-9 PKB00362.HTML