Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SKV_ori

PKB-number: PKB363
Definition: 5\'-terminal ori region
Organism: Sheep Kobuvirus
Abbreviation: SKV_ori
RNA type: Viral 5 UTR
Keywords: Picornaviridae; IRES
EMBL number: GU245693
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Sweeney TR et al. (2012). J. Virol. 86:1468-1486.
Stem sizes:
Loop sizes:
9 4
2 0 45
Position Paired:
46 -54 ; 61 -69 
73 -79 ; 100-106
81 -83 ; 96 -98
85 -87 ; 92 -94
57 -60 ; 115-118
Bracket view of structure:
             50        60        70        80        90
#    123456789|123456789|123456789|123456789|123456789|
$ 41 UUUUCCGGCGGCGCAAGUUCGCGUCGUCGUAAGCCUGGACACCCAUGUUC=90
% 41 :::::(((((((((::[[[[))))))))):::(((((((:(((:(((:::

            100       110       120
#    123456789|123456789|123456789|
$ 91 GCAUCGGUCUCCGGGCAAAUACAAGAACCC=120
% 91 :))):))):)))))))::::::::]]]]::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2012-9-9 PKB00363.HTML