Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BKV_ori

PKB-number: PKB365
Definition: 5\'-terminal ori region
Organism: Bovine Kobuvirus
Abbreviation: BKV_ori
RNA type: Viral 5 UTR
Keywords: Picornaviridae; IRES
EMBL number: AB084788
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Sweeney TR et al. (2012). J. Virol. 86:1468-1486.
Stem sizes:
Loop sizes:
9 4
2 0 57
Position Paired:
46 -54 ; 61 -69 
73 -79 ; 111-117
82 -83 ; 107-108
85 -87 ; 103-105
88 -90 ; 96 -98
57 -60 ; 127-130
Bracket view of structure:
             50        60        70        80        90       100
#    123456789|123456789|123456789|123456789|123456789|123456789|
$ 41 UUUUCCGGCGGCGCAUGUUCGCGUCGUCGUAAGUCUGGAUUCCCAAGGCCCACUCGGUUC=100
% 41 :::::(((((((((::[[[[))))))))):::(((((((::((:((((((:::::)))::

             110       120       130
#     123456789|123456789|123456789|
$ 101 AACUUCGGUUUCCGGACAAAUACAAAGAAC=130
% 101 ::))):))::))))))):::::::::]]]]


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2012-9-9 PKB00365.HTML